View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18109_high_10 (Length: 311)
Name: NF18109_high_10
Description: NF18109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18109_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 292
Target Start/End: Original strand, 9050304 - 9050589
Alignment:
| Q |
7 |
gtttcttctccatcttcttatctagatcagagctaggatgtctccgagcattgcatgcatgcaaggaaatgatgcaaagaaacaaaagaagaatgtatga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9050304 |
gtttcttctccatcttcttatctagatcagaactaggatgtctccgagcattgcatgcatgcaaggaaatgatgcaaagaaacaaaagaagaatgtatga |
9050403 |
T |
 |
| Q |
107 |
gcttgatgacatgttaagacaaagattcttctaaaattttgagctaatcaaacttttgttgtgggatatggaaaatatgaagtgatgatatggtagcagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9050404 |
gcttgatgacatgttaagacaaagattcttctaaaattttgagctaatcaaacttttgttgtgggatatggaaaatatgaagtgatgatatggtagcagc |
9050503 |
T |
 |
| Q |
207 |
agaagaagtatttgtactaacaagggaaatgaatgtgcattaaatgcaatggcttaaagaagaataagaggttaaattgaagaaca |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9050504 |
agaagaagtatttgtactaacaagggaaatgaatgtgcattaaatgcaatggcttaaagaagaataagaggttaaattgaagaaca |
9050589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University