View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18109_high_4 (Length: 457)
Name: NF18109_high_4
Description: NF18109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18109_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 309 - 440
Target Start/End: Complemental strand, 12920088 - 12919957
Alignment:
| Q |
309 |
gatccagcaatacttaagcaaaagcttgaaaaattagagaccaaaatgcaggctttggtggctaagaaagaagaaatattgaagctgcttaaagaagctg |
408 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920088 |
gatccagcaatacttaagcaaaaacttgaaaaattagagaccaaaatgcaggctttggtggctaagaaagaagaaatattgaagctgcttaaagaagctg |
12919989 |
T |
|
| Q |
409 |
aaacaaattcaactgaacctgctgtggcttct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12919988 |
aaacaaattcaactgaacctgctgtggcttct |
12919957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 12920395 - 12920258
Alignment:
| Q |
1 |
atgaatgcatttgtttgcaattgaaaaatcaaaatgaatataaacatgaagttttcaaccacatctaaacaagcttatgaacttgattggttttcagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920395 |
atgaatgcatttgtttgcaattgaaaaatcaaaatgaatataaacatgaagttttcaaccacatctaaacaagcttatgaacttgattggttttcagaga |
12920296 |
T |
|
| Q |
101 |
aaataaaaaacacaaattttgttcaagtatgggagtaac |
139 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12920295 |
aaata-aaaacacaaactttgttcaagtatgggagtaac |
12920258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University