View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18109_low_12 (Length: 311)

Name: NF18109_low_12
Description: NF18109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18109_low_12
NF18109_low_12
[»] chr4 (1 HSPs)
chr4 (7-292)||(9050304-9050589)


Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 292
Target Start/End: Original strand, 9050304 - 9050589
Alignment:
7 gtttcttctccatcttcttatctagatcagagctaggatgtctccgagcattgcatgcatgcaaggaaatgatgcaaagaaacaaaagaagaatgtatga 106  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9050304 gtttcttctccatcttcttatctagatcagaactaggatgtctccgagcattgcatgcatgcaaggaaatgatgcaaagaaacaaaagaagaatgtatga 9050403  T
107 gcttgatgacatgttaagacaaagattcttctaaaattttgagctaatcaaacttttgttgtgggatatggaaaatatgaagtgatgatatggtagcagc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9050404 gcttgatgacatgttaagacaaagattcttctaaaattttgagctaatcaaacttttgttgtgggatatggaaaatatgaagtgatgatatggtagcagc 9050503  T
207 agaagaagtatttgtactaacaagggaaatgaatgtgcattaaatgcaatggcttaaagaagaataagaggttaaattgaagaaca 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9050504 agaagaagtatttgtactaacaagggaaatgaatgtgcattaaatgcaatggcttaaagaagaataagaggttaaattgaagaaca 9050589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University