View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18109_low_15 (Length: 297)
Name: NF18109_low_15
Description: NF18109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18109_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 102 - 290
Target Start/End: Original strand, 24142037 - 24142225
Alignment:
| Q |
102 |
attatagcatagcggaattggaacaagccactattgctcaaggttacactatctagtataaaatgttgtcaaatataacactgtaacagaggaatgtgag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142037 |
attatagcatagcggaattggaacaagccactattgttccaggttacactatctagtataaaatgttgtcaaatataacactgtaacagaggaatgtgag |
24142136 |
T |
|
| Q |
202 |
caaatcgctattttctgagattcacaatcatcaaccttgcatcttactatgatgtgtgatcttttcaacaaattttattatttcatctc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142137 |
caaatcgctattttctgagattcacaatcatcaaccttgcatcttactatgatgtgtgatcttttcaacaaattttattatttcatctc |
24142225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 101
Target Start/End: Original strand, 24141905 - 24141942
Alignment:
| Q |
64 |
accaccgttggataacgagacaaagtcgggtgcaaaga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24141905 |
accaccgttggataacgagacaaagtcgggtgcaaaga |
24141942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 106 - 175
Target Start/End: Original strand, 50322030 - 50322099
Alignment:
| Q |
106 |
tagcatagcggaattggaacaagccactattgctcaaggttacactatctagtataaaatgttgtcaaat |
175 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||| || | | ||||| || ||||||||||| ||||||||| |
|
|
| T |
50322030 |
tagcatagtggaatttgaacaaaccactattgttctacgatacacaatttagtataaaatattgtcaaat |
50322099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University