View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18109_low_22 (Length: 245)
Name: NF18109_low_22
Description: NF18109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18109_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 10789525 - 10789743
Alignment:
| Q |
18 |
aaaacccactatttaaactgtagtataaccaagttattgcaaaagttttattnnnnnnnttgtccaaaaatcatttttctttaattcatttaggat-aac |
116 |
Q |
| |
|
|||||| |||||||||| ||||||||||| || |||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10789525 |
aaaacctactatttaaattgtagtataactaatttattgcaaaagttttataaaaaaaattctccaaaaatcatttttctttaattcatttaggattaac |
10789624 |
T |
 |
| Q |
117 |
atctagggacgtgggacgtgtattcgagttatggttggtagttggtacgtgaatcacaacaaacattgatggtcgaatcaatattatgtcagctaatatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10789625 |
atctagggacgtgggacgtgtattcgaaatatggttggtagttggtacgtgaatcacaacaaacattgatggtcgaatcaatattatgtcagctaatatt |
10789724 |
T |
 |
| Q |
217 |
ggtccaacattattttcaa |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10789725 |
ggtccaacattattttcaa |
10789743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University