View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1810_high_11 (Length: 216)
Name: NF1810_high_11
Description: NF1810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1810_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 107 - 198
Target Start/End: Original strand, 37326306 - 37326397
Alignment:
| Q |
107 |
gctattattactgtgttgttaatgatgtttgatcagttattagtagtaatgaagttaaatattggggcaatactagtgcgttagattttcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37326306 |
gctattattactgtgttgttaatgatgtttgatcagttattagtagtaatgaagttaaatattggggcaatactagtgcgttagattttcat |
37326397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 37326214 - 37326268
Alignment:
| Q |
16 |
cttcgcttctatgatgctcatgttgttgaggttcgtcgttttcttccaaacgccg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37326214 |
cttcgcttctatgatgctcatgttgttgaggttcgtcgttttcttccaaacgccg |
37326268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University