View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1810_high_5 (Length: 243)
Name: NF1810_high_5
Description: NF1810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1810_high_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 54639347 - 54639122
Alignment:
| Q |
19 |
aatggcaccttcacttttgaaagcatgatttcacaattatatgctcgcctatgatcaatctgcaagga-tgataataaaagttcaagtaaaaataaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54639347 |
aatggcaccttcacttttgaaagcatgatttcacaattatatgctcgcctatgatcaatctgcaaggagtgataataaaagttcaagtaaaaataaagat |
54639248 |
T |
 |
| Q |
118 |
gatgataataccacctttatagtatgaccttaaaatgtatatcaatgagaaaatgataattagagcttttttaccatttattacttcacacacatgacta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54639247 |
gatgataataccacctttatagtatgaccttaaaatgtatatcaatgagaaaatgataattagagcttttttaccatttattacttcacacacatgacta |
54639148 |
T |
 |
| Q |
218 |
tacaagtgaactctaatagttctgta |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
54639147 |
tacaagtgaactctaatagttctgta |
54639122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University