View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1810_low_6 (Length: 246)
Name: NF1810_low_6
Description: NF1810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1810_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 44999024 - 44998812
Alignment:
| Q |
14 |
atatgatcatatgaaaatcccagttgaatgaatgggaagttgtgatgggacccattaggagagtccctgagtcgtcacgtgttcggatgaacgtgtcacg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999024 |
atatgatcatatgaaaatcccagttgaatg----ggaagttgtgatgggacccattaggagagtccctgagtcgtcacgtgttcggatgaacgtgtcacg |
44998929 |
T |
|
| Q |
114 |
gcaagaaagtactgttcaaacggttcgtgaaggaactatacactactacacaacacaggaatctgactggtttcaagtcagagtcagattcagaagaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998928 |
gcaagaaagtactgttcaaacggttcgtgaaggaactatacactactacacaacacaggaatctgactggtttcaagtcagagtcagattcagaagaaga |
44998829 |
T |
|
| Q |
214 |
tagatccacatagatat |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44998828 |
tagatccacatagatat |
44998812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University