View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18110_low_11 (Length: 251)
Name: NF18110_low_11
Description: NF18110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18110_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 104 - 242
Target Start/End: Complemental strand, 33570740 - 33570602
Alignment:
| Q |
104 |
aagaaactaatgagagaaaaggaagcaacaaggcaaaagcataacaatattatatgaaacgatgaatgcgtcgtttatttgctgtttaagaacatatcct |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| || ||||||| |
|
|
| T |
33570740 |
aagaaacccatgagagaaaaggaagcaacaaggcaaaagcataacaatattatatgaaacgatgaatgggttgtttatttgctgtttaaaaaaatatcct |
33570641 |
T |
 |
| Q |
204 |
cttcatttgcaatgattgagtagatttgtagtgatgatg |
242 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570640 |
ttttatttgcaatgattgagtagatttgtagtgatgatg |
33570602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University