View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18110_low_12 (Length: 239)
Name: NF18110_low_12
Description: NF18110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18110_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 10838446 - 10838656
Alignment:
| Q |
10 |
gagcagagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattggaaatgctgggagaagaacattcagccgcggttcttgtgaaaaggtt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10838446 |
gagcaaagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattggaaatgctgggagaagagcattcagccgcggttcttgtgaaaaggtt |
10838545 |
T |
 |
| Q |
110 |
ggatttttggctttattatattgcatacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatctttaggccacagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10838546 |
ggatttttggctttattatattgcatacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatctttaggccacagt |
10838645 |
T |
 |
| Q |
210 |
tatagaacgtc |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
10838646 |
tatagaacgtc |
10838656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 30349649 - 30349585
Alignment:
| Q |
133 |
catacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatct |
197 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| ||||||||| |
|
|
| T |
30349649 |
catacttctgtggaggtacgattggtcttgtctatagcaataatctgggacagattgctcaatct |
30349585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University