View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18110_low_8 (Length: 328)
Name: NF18110_low_8
Description: NF18110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18110_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 138 - 306
Target Start/End: Complemental strand, 43054994 - 43054826
Alignment:
| Q |
138 |
tcgatcgattgatgaaagtacctgagggaaattagcactctgagcccaaacgctaccgtctacaccgaggatagcagcatgagtgagatgattaccttca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054994 |
tcgatcgattgatgaaagtacctgagggaaattagcactctgagcccaaacgctaccgtctacaccgaggatagcagcatgagtgagatgattaccttca |
43054895 |
T |
|
| Q |
238 |
atgtcacagagaaggtgatcatcaacataagtttgccacgacatggttcaaagattttctcaggaaaat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054894 |
atgtcacagagaaggtgatcatcaacataagtttgccacgacatggttcaaagattttctcaggaaaat |
43054826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 43055117 - 43055070
Alignment:
| Q |
15 |
cagagatcggaaaatctagaatatttgataaacaaaagaatgaaactc |
62 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43055117 |
cagagatcggaaaatctagaataattgataaacaaaagaatgaaactc |
43055070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University