View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18111_high_23 (Length: 237)
Name: NF18111_high_23
Description: NF18111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18111_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 52379366 - 52379572
Alignment:
| Q |
12 |
aagaaaagaagaactaaattcatcatatatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgcactgcatggatttt |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52379366 |
aagaaaagaagaactaaattcat---atatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgtactgcatggatttt |
52379462 |
T |
|
| Q |
112 |
ttaagatgatggctttagaatgaaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgta |
211 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379463 |
-taagatgatagctttacaatgaaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgta |
52379561 |
T |
|
| Q |
212 |
tgttggcagtg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
52379562 |
tgttggcagtg |
52379572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University