View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18111_low_18 (Length: 283)
Name: NF18111_low_18
Description: NF18111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18111_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 42068479 - 42068211
Alignment:
| Q |
1 |
tgacccatatacaaaatgtattaagattttacgttaaaatattatgtttaaatcatttatatggttgcccttgattcaacgtggaacccgag---ctccc |
97 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
42068479 |
tgacccatatacaaaatatcttaagattttacgttaaaatattatgtttaactcatttatatgattgcccttgattcaacgtggaacccgagctcctccc |
42068380 |
T |
 |
| Q |
98 |
ttcatgagcaaacaaaaatacaacccacttgaggggtgatagaagatagaga--gtagtattgattctgagtatagtttgccaattgaccaatcaacaac |
195 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42068379 |
ttcatgatcaaacaaaaatacaacccacttgaggggtgatagaagatagagagggtagtattgattctgagtatagtttgccaattgaccaatcaacaac |
42068280 |
T |
 |
| Q |
196 |
actatttacttcacgataaacatatgcttcacatagacctctcaaccacgatccaatcaatacttccatgt |
266 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42068279 |
actatttacttcacgataaac--atgcttcacatagacctctcaaccacgatccaatcaatacttccatgt |
42068211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University