View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18111_low_28 (Length: 208)

Name: NF18111_low_28
Description: NF18111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18111_low_28
NF18111_low_28
[»] chr4 (2 HSPs)
chr4 (119-188)||(758800-758869)
chr4 (1-55)||(758682-758736)
[»] chr3 (4 HSPs)
chr3 (119-188)||(36988506-36988573)
chr3 (119-188)||(37013945-37014012)
chr3 (1-55)||(36988637-36988689)
chr3 (1-55)||(37014076-37014128)
[»] chr2 (1 HSPs)
chr2 (120-188)||(19181174-19181240)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 119 - 188
Target Start/End: Original strand, 758800 - 758869
Alignment:
119 gatgggttagctaattgcaacaaatgatgggcaagagcttaatatatatagccaggagaggtgatgatat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
758800 gatgggttagctaattgcaacaaatgatgggcaagagcttaatatatatagccaggagaggtgatgatat 758869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 758682 - 758736
Alignment:
1 tttctcttcttcttcatctctctgcgtgtgtttctaaacaaaagaggtttataga 55  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
758682 tttctcttcttcttcatctctctgcgtgtgtttctaaacaaaagaggtttataga 758736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 119 - 188
Target Start/End: Complemental strand, 36988573 - 36988506
Alignment:
119 gatgggttagctaattgcaacaaatgatgggcaagagcttaatatatatagccaggagaggtgatgatat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
36988573 gatgggttagctaattgcaacaaatgatgggcaagagcttaata--tatagccaggagaggtgatgatat 36988506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 119 - 188
Target Start/End: Complemental strand, 37014012 - 37013945
Alignment:
119 gatgggttagctaattgcaacaaatgatgggcaagagcttaatatatatagccaggagaggtgatgatat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
37014012 gatgggttagctaattgcaacaaatgatgggcaagagcttaata--tatagccaggagaggtgatgatat 37013945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 36988689 - 36988637
Alignment:
1 tttctcttcttcttcatctctctgcgtgtgtttctaaacaaaagaggtttataga 55  Q
    |||||||||||||||||||||||||||||||||||||||  ||||||||||||||    
36988689 tttctcttcttcttcatctctctgcgtgtgtttctaaac--aagaggtttataga 36988637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 37014128 - 37014076
Alignment:
1 tttctcttcttcttcatctctctgcgtgtgtttctaaacaaaagaggtttataga 55  Q
    |||||||||||||||||||||||||||||||||||||||  ||||||||||||||    
37014128 tttctcttcttcttcatctctctgcgtgtgtttctaaac--aagaggtttataga 37014076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 188
Target Start/End: Original strand, 19181174 - 19181240
Alignment:
120 atgggttagctaattgcaacaaatgatg-ggcaagagcttaatatatatagccaggagaggtgatgatat 188  Q
    ||||||||||||||||||||||| || | || |||||||||  |||||||||| ||||||||||||||||    
19181174 atgggttagctaattgcaacaaacgaggtggaaagagctta--atatatagcc-ggagaggtgatgatat 19181240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University