View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18112_low_5 (Length: 253)
Name: NF18112_low_5
Description: NF18112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18112_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 30947278 - 30947053
Alignment:
| Q |
18 |
acaaatgccattgattcgtgttgaatgatgaaattcgattggtgatgaagatgatcgagtgttgattgggaatgtcgaagggagagaacggaaatggcga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30947278 |
acaaatgccattgattcgtgttgaatgatgaaatttgattggtgatgaagatgatcgagtgttgattgggaatgtcgaagggagagaacggaaatggcga |
30947179 |
T |
|
| Q |
118 |
gggagaacagagagaacgaacgaaagtgaaagcgtggaaaattaaaagaataagaactaccggcactttgatatgtttcttacataacttcaaacttgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30947178 |
gggagaacagagagaacgaacgaaagtgaaagcgtggaaaatcaaaagaataagaactaccggcactttgatatgtttcttacataacttcaaacttgga |
30947079 |
T |
|
| Q |
218 |
atttcatgtaacagcttttcttcatc |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30947078 |
atttcatgtaacagcttttcttcatc |
30947053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University