View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18113_low_10 (Length: 250)
Name: NF18113_low_10
Description: NF18113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18113_low_10 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 151 - 250
Target Start/End: Complemental strand, 7067891 - 7067792
Alignment:
| Q |
151 |
ctctctgatcacaattccaacctcaaaatcttaactttcaccctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067891 |
ctctctgatcacaattccaacctcaaaatcttaactttcatcctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca |
7067792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 7068035 - 7067976
Alignment:
| Q |
8 |
ccaagaaaatgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7068035 |
ccaacaaaatgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg |
7067976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University