View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18113_low_11 (Length: 241)
Name: NF18113_low_11
Description: NF18113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18113_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 7067732 - 7067524
Alignment:
| Q |
17 |
aagattcagttttgttgttcttgttgtgcagtttgattttcaaacatgggttgtgttcacggaaagtgttgtagtcgttatcctgcaccatcaattggtg |
116 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067732 |
aagattcagttttgttgttcttgctgtgtagtttgattttcaaacatgggttgtgttcacggaaagtgttgtagtcgttatcctgcaccatcaattggtg |
7067633 |
T |
|
| Q |
117 |
gctctagggattatagagaacctgtccctaagaagcacatactcacacaaaggtcacttcactttgttgatgttgcttcacacaatttcactatggaata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7067632 |
gctctagggattatagagaacctgtccctaagaagcacatactcacacaaaggtcacttcactttgttgatgttgcttcacacaatttcactatggaata |
7067533 |
T |
|
| Q |
217 |
ctctgtact |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
7067532 |
ctctgtact |
7067524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University