View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18113_low_13 (Length: 213)
Name: NF18113_low_13
Description: NF18113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18113_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 44 - 197
Target Start/End: Complemental strand, 6189877 - 6189724
Alignment:
| Q |
44 |
caacccagataaggatgaaaaagcaaatgagtatccgcaggtaaaatgagcgtgcaacccaaaagttaatttgcgatctgaattgtctgattataaatgt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6189877 |
caacccagataaggatgaaaaagcaaatgagtatccgcaggtaaaatgagcgtgcaacccaaaagttaatttgcgatctgaattgtctgattataaatgt |
6189778 |
T |
|
| Q |
144 |
gagtaagttgaagatgccacttgttcatcatcagactcctattgttctagttat |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6189777 |
gagtaagttgaacatgccacttgttcatcatcagactcctattgttctagttat |
6189724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University