View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18114_low_15 (Length: 293)

Name: NF18114_low_15
Description: NF18114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18114_low_15
NF18114_low_15
[»] chr2 (1 HSPs)
chr2 (1-242)||(11025274-11025515)


Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 11025274 - 11025515
Alignment:
1 aggataatcagtactctcagcaaaagtatctacacaagaggtatggtatgaaagaatcgcgctaaattgggcatttacttcttgagcattgcgcacagcg 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
11025274 aggataatcattactctcagcaaaagtatctacacaagaggtatggtatgaaagaatcccgctaaattgagcatttacttcttgagcattgcgcacagcg 11025373  T
101 agggccgcaacggcattggttatagaatcgggcatcatttcatattgttgcttgcaacaatcaagtgatccacttacgtctgcgttgtttgcatatttag 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11025374 agggccgcaacggcattggttatagaatcaggcatcatttcatattgttgcttgcaacaatcaagtgatccacttacgtctgcgttgtttgcatatttag 11025473  T
201 gtatcagagatgtaatgatagctaacgttttattgatttgta 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
11025474 gtatcagagatgtaatgatagctaacgttttattgatttgta 11025515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University