View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18115_high_25 (Length: 208)
Name: NF18115_high_25
Description: NF18115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18115_high_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 3 - 189
Target Start/End: Complemental strand, 7993646 - 7993460
Alignment:
| Q |
3 |
ttggcaatgaataacaggccgcccttaccaagaaaagtattggaacaattgagagaggtcaaagttttaatgttttgcgcaaatgctcgcagaccatagc |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||||| ||||||| |
|
|
| T |
7993646 |
ttggcaatgagtaacaggccgcccttaccaagaaaagtattggaacaattgagagaggtcaaaattgtaatgttttgggcaaatgctcgcaaaccatagg |
7993547 |
T |
|
| Q |
103 |
cgggaaagatgccttggtcggagatattaagggatgtgatgttcaatgatgggaaagtagagatttcccggagaaccttgtcaaggt |
189 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
7993546 |
cgggaaagttgcattggtcggagatattaagggatgtgatgttcaatgatgggaaagtagagatttcccgcagaaacttgtcaaggt |
7993460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 177
Target Start/End: Original strand, 6417164 - 6417225
Alignment:
| Q |
116 |
ttggtcggagatattaagggatgtgatgttcaatgatgggaaagtagagatttcccggagaa |
177 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
6417164 |
ttggttggagatattaagtgatgtgatgttcaatgatggaaaacgagagattttacggagaa |
6417225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 78
Target Start/End: Complemental strand, 8913478 - 8913442
Alignment:
| Q |
42 |
ttggaacaattgagagaggtcaaagttttaatgtttt |
78 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
8913478 |
ttggaacaattgagagaggtcaaagttgtaatctttt |
8913442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 177
Target Start/End: Original strand, 10615785 - 10615846
Alignment:
| Q |
116 |
ttggtcggagatattaagggatgtgatgttcaatgatgggaaagtagagatttcccggagaa |
177 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
10615785 |
ttggttggaaatattaagtgatgtgatgttcaatgatgggaaacgagagattttgcggagaa |
10615846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University