View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18115_low_18 (Length: 355)
Name: NF18115_low_18
Description: NF18115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18115_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 303407 - 303620
Alignment:
| Q |
14 |
atattgtctcaaagcatgagtggaagctgctctgaacaagtgaacatgctagtgcaacccttcaatgaaaatgtgaaggctatgttgagcaatctcaaca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
303407 |
atattgtctcaaagcatgagtggaagctgctctgaacaagtgaacatgctagtgcaacccttcaatgaaaatgtgaaggttatgttgagcaatctcaaca |
303506 |
T |
 |
| Q |
114 |
ataatctacctggttccagattcatattcattgacagttcccgcatgtttcaggaaattcttttcaatgcaagatcatatggtatgaatctaacataaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303507 |
ataatctacctggttccagattcattttcattgacagttcccgcatgtttcaggaaattcttttcaatgcaagatcatatggtatgaatctaacataaaa |
303606 |
T |
 |
| Q |
214 |
tagcatatatcaat |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
303607 |
tagcatatatcaat |
303620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 271 - 355
Target Start/End: Original strand, 303671 - 303755
Alignment:
| Q |
271 |
tttgtttgtgtgtaggatttactgatgtgaatagagggtgttgtgggcttggaagaaacagaggtcaaataacttgtctaccatt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303671 |
tttgtttgtgtgtaggatttactgatgtgaatagagggtgttgtggccttggaagaaacagaggtcaaataacttgtctaccatt |
303755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University