View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18115_low_19 (Length: 342)
Name: NF18115_low_19
Description: NF18115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18115_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 18 - 332
Target Start/End: Complemental strand, 43683 - 43369
Alignment:
| Q |
18 |
gttgaaatgaatcaattgataaattcctctttcaccaggagatgaaattgaatcttgaacatccaaagatcaacggagaaactactgttcaaaacgctat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43683 |
gttgaaatgaatcaattgataaattcctctttcaccaggagatgaaattgaatcttgaacatccaaagatcaacggagaaactactgttcaaaacgctat |
43584 |
T |
 |
| Q |
118 |
cactgaagtagctgccatcatgggagagaatgtgaagctaagaagaggttatctgatgcacgcaccatctaatggtcttgtatctacatatcttcatacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43583 |
cactgaagtagctgccatcatgggagagaatgtgaagctaagaagaggttatctgatgcacgcaccatctaatggtcttgtatctacatatcttcatacc |
43484 |
T |
 |
| Q |
218 |
agtcccctacctggtaactaaccgctcaaactcacaattgattctgactaatcagagtattctcaatagaatataatttaattctttttcaaatggattc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483 |
agtcccctacctggtaactaaccgctcaaactcacaattgattctgactaatcagagtattctcaatagaatataatttaattctttttcaaatggattc |
43384 |
T |
 |
| Q |
318 |
taacttaaacctatg |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43383 |
taacttaaacctatg |
43369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University