View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18116_low_7 (Length: 265)
Name: NF18116_low_7
Description: NF18116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18116_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 57 - 251
Target Start/End: Original strand, 42394863 - 42395057
Alignment:
| Q |
57 |
tcatacaatgtgtagtagggctaaatggacattgaaatggctttttgaagattcctaaaagctttctcatatcgtaaaaatcccataaatcaaaattcag |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42394863 |
tcatacaatgtgtagtagggctaaatggacattgaaatggctttttgaagattcctaaaagctttctcatatcgtaaaaatcccataaaccaaaattcag |
42394962 |
T |
|
| Q |
157 |
aatcatcgtgagtaacaatttctatatacttttgttcttcctgattcacattctgcccttcattgacttcttttatcttcccaattggtatcaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394963 |
aatcatcgtgagtaacaatttctatatacttttgttcttcctgattcacattctgcccttcattgacttcttttatcttcccaattggtatcaaa |
42395057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 116 - 251
Target Start/End: Complemental strand, 29296933 - 29296798
Alignment:
| Q |
116 |
agctttctcatatcgtaaaaatcccataaatcaaaattcagaatcatcgtgagtaacaatttctatatacttttgttcttcctgattcacattctgccct |
215 |
Q |
| |
|
|||||||||||| | |||||||||||| || ||||||||||| ||||| | ||| || | ||||||||| || |||||| || ||||||||| | | |
|
|
| T |
29296933 |
agctttctcataccttaaaaatcccatgaaccaaaattcagagtcatccttagtcactacttctatatatttctgttctagcttgttcacattcatgctt |
29296834 |
T |
|
| Q |
216 |
tcattgacttcttttatcttcccaattggtatcaaa |
251 |
Q |
| |
|
||||| || |||||||||||| | |||||||||||| |
|
|
| T |
29296833 |
tcattcacctcttttatcttctccattggtatcaaa |
29296798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University