View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18117_high_3 (Length: 316)
Name: NF18117_high_3
Description: NF18117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18117_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 37 - 304
Target Start/End: Complemental strand, 27685889 - 27685623
Alignment:
| Q |
37 |
cttctgattaataggaagtgggttcaagtcaaatcgtccatttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagtt |
136 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685889 |
cttctgattaataggaagtggattcaagtcgaatcgtccatttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagtt |
27685790 |
T |
 |
| Q |
137 |
ataacagctttttatgtaagattaagatatgatcatgatt-nnnnnnntgaagttgattaatggaaggttaaacattttttaaaaaatttgagtgtgtga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27685789 |
ataacagctttttatgtaagattaagatatgatcatgattaaaaaaaatgaagttgattaatggaaggttaaacatttttaaaaaaatttga--gtgtga |
27685692 |
T |
 |
| Q |
236 |
taaattttactaatgagttgattaattgcagctttctaacaatgaagcacatccaggatttcatgatga |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685691 |
taaattttactaatgagttgattaattgcagctttctaacaatgaagcacatccaggatttcatgatga |
27685623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 77 - 158
Target Start/End: Original strand, 41268734 - 41268815
Alignment:
| Q |
77 |
tttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttataacagctttttatgtaagat |
158 |
Q |
| |
|
|||||||| || |||||||| ||||| ||||||||||| ||||| || |||||||||||||||||| |||| |||||||||| |
|
|
| T |
41268734 |
tttcgatctggctactttggtgcttccattaagcttcaacctggttatactgcaggagttataacatctttctatgtaagat |
41268815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 86 - 138
Target Start/End: Complemental strand, 21085459 - 21085407
Alignment:
| Q |
86 |
ggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttat |
138 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21085459 |
ggatactttggtgctgcaattaagcttcatcctggctatactgctggagttat |
21085407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University