View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18117_low_6 (Length: 319)
Name: NF18117_low_6
Description: NF18117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18117_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 488429 - 488186
Alignment:
| Q |
18 |
agttggggatttgccggagttgcatttctggcaaactacgtcgtcgtcgttgttgttgaaggtcgtggattgttttttgggagctggaattcttcttcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488429 |
agttggggatttgccggagttgcatttctggcaaactacgtcgtcgtcgttgttgttgaaggtcgtggattgttttttgggagctggaattcttcttcgg |
488330 |
T |
|
| Q |
118 |
cgaagtggtgaagccatggtgagatttgggatttgagaatgaatcggcgttgtttgtgtaagaaatga-------gaaaggagaatgaggaataataggt |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
488329 |
cgaagtggtgaaaccatggtgagatttgggatttgagaatgaatcggcgttgtttgtgtaagaaatgagaaatgagaaaggagaatgaggaataataggt |
488230 |
T |
|
| Q |
211 |
tttgtaattaagtaagaattggaagaggcgttttcgcggggtta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488229 |
tttgtaattaagtaagaattggaagaggcgttttcgcggggtta |
488186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 500525 - 500482
Alignment:
| Q |
19 |
gttggggatttgccggagttgcatttctggcaaactacgtcgtc |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
500525 |
gttggggatttgccggagttgcatttctggcaaacaatgtcgtc |
500482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University