View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18118_low_15 (Length: 239)
Name: NF18118_low_15
Description: NF18118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18118_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 9788642 - 9788422
Alignment:
| Q |
19 |
ccattggcccatgtgaaggtgtttaactttattaagcaatcaacaatgtttggaaagctcccttaatttacaaccnnnnnnnnnatcagaatactgcatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9788642 |
ccattggcccatgtgaaggtgtttaactttattaagcaatcaacaatgtttggaaagctcccttaatttacaacctttttttttatcagaatactgcatg |
9788543 |
T |
 |
| Q |
119 |
attaatcctcaatactccactccaacctcttgttacaaacgataaatagaattggaaggctgaaaagaaggataattattccgttcgtaatgcttatcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9788542 |
attaatcctcaatactccactccaacctcttgttacaaacgataaatagaattggaaggctgaaaagaaggataattattccgttcgtaatgcttatcaa |
9788443 |
T |
 |
| Q |
219 |
atttgtgtgaacgagattgtt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9788442 |
atttgtgtgaacgagattgtt |
9788422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University