View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18118_low_6 (Length: 383)
Name: NF18118_low_6
Description: NF18118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18118_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 372
Target Start/End: Complemental strand, 952295 - 951945
Alignment:
| Q |
18 |
aaataaggaggtgcaagtcaatatgaaaattaaataaaagttgttttatgttttcagtttatatatcaannnnnnnaacctttatctctacatatttgtt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
952295 |
aaataaggaggtgcaggtcaatatgaaaattaaa----agttgttttatgttttcagtttatatatcaatttttttaagctttatctctacatatttgtt |
952200 |
T |
 |
| Q |
118 |
tccttgacttcctaaaatttctttttaagatttatgtatcaagatttgtttcgattaaaattgtttattactgctctagctttattgtgttcgtgattct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952199 |
tccttgacttcctaaaatttctttttaagatttatgtatcaagatttgtttcgattaaaattgtttattactgctctagctttattgtgttcgtgattct |
952100 |
T |
 |
| Q |
218 |
cgtatgtcatttgccacannnnnnncaatgtagtttaatttggattgcaatggtttgtctgttttccccgcagttgaaccttgtacgaccaaaaataaaa |
317 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
952099 |
cgtatgccatttgccacatttttttcaatgtagtttaatttggattgcaatggtttgtctgttttccccgcagttgaaccttgtacgaccaataataaaa |
952000 |
T |
 |
| Q |
318 |
tctcaaaggatagattgagtgttggacaaatcatgtacaatttagcatgatgatg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
951999 |
tctcaaaggatagattgagtgttggacaaatcatgtacaatttagcatgatgatg |
951945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University