View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1811_high_3 (Length: 249)
Name: NF1811_high_3
Description: NF1811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1811_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 24868799 - 24868568
Alignment:
| Q |
1 |
atactctgggcttgtaggtttcagttctaaatcaaatt-gtaaattgactgaaaaactacttctagctaatatcttttgttactgtaatctgttccataa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24868799 |
atactctgggcttgtaggtttcagttctaaatcaaatttgtaaattgactgaaaaactacttctagctaatatcttttgttactgtaatctgttccataa |
24868700 |
T |
 |
| Q |
100 |
ttcttcaaattgaacactattttcttgcatacagtttttcgtgagatctcttcaaaaatatttacaaataacactacaattgcaggctttaactttaaca |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24868699 |
ttcttcaaattgaacattattttcttgcatacagttttttgtgagatctcttcaaaaatatttacaaataacact--aattgcaggctttaactttaaca |
24868602 |
T |
 |
| Q |
200 |
ttaacattaaagacaagcataatccagaagattc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24868601 |
ttaacattaaagacaagcataatccagaagattc |
24868568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University