View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18120_high_10 (Length: 313)
Name: NF18120_high_10
Description: NF18120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18120_high_10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 11 - 313
Target Start/End: Complemental strand, 7319051 - 7318749
Alignment:
| Q |
11 |
tgagaagaaacatgcttgtcttttcagtatgttatagaccgttgagatttgatgtcaaacttagtgttttttatgtaaagggaatgaataaatattttga |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7319051 |
tgagaagaaacatgcttgtcttttcggtacgttatagaccgttcagatttgatgtcaaacttagtgttttttatgtaaagggaatgaataaatattttga |
7318952 |
T |
 |
| Q |
111 |
atcttgattgtatttttcatgtctaaggtttattattttatgagtttagtatttactcttgttgccttgttgcagttcactcttttttaactattgtttt |
210 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7318951 |
atcttgattgtatttttcatgtccaagatttattattttatgagtttagtatttactcttgttgccttgttgcagttcactcttttttaactattgtttt |
7318852 |
T |
 |
| Q |
211 |
tgttaagcctcaggttcttagagggataaggtcttgataattcggagatcggtcatgaagtaattatagtatggttaagaattctttcactcagaaattg |
310 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7318851 |
tgttaagccttaggttcttagagagataaggtcttgataattcggagatcggtcatgaagtaattatagtatggttaagaattctttcactcagaaattg |
7318752 |
T |
 |
| Q |
311 |
aat |
313 |
Q |
| |
|
||| |
|
|
| T |
7318751 |
aat |
7318749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University