View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18120_low_14 (Length: 273)
Name: NF18120_low_14
Description: NF18120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18120_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 43875174 - 43874907
Alignment:
| Q |
1 |
caccgcatccaccacttaccatcactggtcctctcatcttcttctccacacaaacaatatcttcttatgagtagagaagagacaaattttgattttgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875174 |
caccgcatccaccacttaccatcactggtcctctcatcttcttctccacacaaacaatatcttcttatgagtagagaagagacaaattttgattttgaat |
43875075 |
T |
 |
| Q |
101 |
atgaggatga-----gttnnnnnnnnnnnnnnnnnnnaaatgaatgatgttatgaaggctcttgtattactcttgtgaacttcaacggccactcgttttt |
195 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43875074 |
atgaggatgagttttgttgggttgtgttgtgttgtgtaaatgaatgatgttatgaaggctcttgtattactcttgtgaacttcaacggccacttgttttt |
43874975 |
T |
 |
| Q |
196 |
caaattttggttaactttatctacagttccttcttgtccttttttgccctctaggtatattatattct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43874974 |
caaattttggttaactttatctacagttccttcttgtccttttttgccctctaagtatattatattct |
43874907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University