View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18120_low_15 (Length: 266)
Name: NF18120_low_15
Description: NF18120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18120_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 4158878 - 4159120
Alignment:
| Q |
11 |
caaaggttaacacggcaataccnnnnnnngttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158878 |
caaaggttaacacggcaataccaaaaaaagttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct |
4158977 |
T |
|
| Q |
111 |
gtccctttatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacattagcaaacaagttgacttagattct |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4158978 |
gtccctatatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacattagcaaacaagttgacttagattct |
4159077 |
T |
|
| Q |
211 |
cccattaatagatcgtacataagcttagta-aaagaaaattat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4159078 |
cccattaatagatcgtacataagcttagtagaaagaaaattat |
4159120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University