View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18121_high_11 (Length: 287)
Name: NF18121_high_11
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18121_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 22 - 268
Target Start/End: Original strand, 37049293 - 37049539
Alignment:
| Q |
22 |
ataacattactgtaaagataaagaacaaaaccagatccagttgcagccaagacaagacaatctctatgatcaatccaagcagagagagcttccttctgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37049293 |
ataacattactgtaaagataaagaacaaaaccagatccagttgcagccaagacaagacaatctctatgatcaatccaagcagagagagcttccttctgaa |
37049392 |
T |
 |
| Q |
122 |
aacttttcaacgatgaaaaaccaaaatgcttttgcaacaaaatgctagctttttgctgccaatcagatgcaacatcgatagcatgagctacaccggaatc |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37049393 |
aacttttcaaagatgaaaaaccaaaatgcttttgcaacaaaatgctagctttttgctgccaatcagatgcaacatcgatagcatgagctactgcggaatc |
37049492 |
T |
 |
| Q |
222 |
atgatcaaatcccattcgcggtaagaactctttctccttgtgctctt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37049493 |
atgatcaaatcccattcgcggtaagaactctttctccttgtgctctt |
37049539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University