View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18121_high_14 (Length: 252)
Name: NF18121_high_14
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18121_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 51822795 - 51822559
Alignment:
| Q |
1 |
cttaacggagttaacagaattagaattcgccgataatttcattaccggagaatttcccggtgagattgtcaaccttcacaagctctggcagcttgaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822795 |
cttaacggagttaacagaattagaattcgccgataattccattaccggagaatttcccggtgagattgtcaaccttcacaagctctggcagcttgaattc |
51822696 |
T |
 |
| Q |
101 |
tacaacaattccttcaccgggaagattccgattgggttgagaaatctcacaggactcgagtatttggacggatcgatgaatcaattagaaggaaatctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51822695 |
tacaacaattccttcaccgggaagattccgattgggttgagaaatctcacaggactcgagtatttggacggatcaatgaatcaattagaaggaaatctct |
51822596 |
T |
 |
| Q |
201 |
ctgagataaggtttttaagtaatctaatttcacttca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822595 |
ctgagataaggtttttaagtaatctaatttcacttca |
51822559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University