View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18121_high_15 (Length: 252)
Name: NF18121_high_15
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18121_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 24681914 - 24682152
Alignment:
| Q |
10 |
attatactgggtggcagcttttcggtacacggccttgcgttgtcgtcagccgtacgccgttgagcagcagtctttataagcatgtcatctatgaatgatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24681914 |
attatactgggtggcagcttttcggtacacggccttgcgttgtcgtcagccgtacgccgttgagcagcagtctttataagcatgtcatctatgaatgatc |
24682013 |
T |
|
| Q |
110 |
cgatgaaactagagatggaataaaacctagcttttcgtcacgcgaattagccgccagtctttgaggtcgccttccttgcttgacagtatggcctgcgggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24682014 |
cgatgaaactagagatggaataaaacctagcttttcgtcacgcgaattagccgccagtctttgaggtcgccttccttgcttgacagtatagcctgcgggt |
24682113 |
T |
|
| Q |
210 |
gaaatccccgatgtcgtattgtacatgggaataaaaatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24682114 |
gaaatccccgatgtcgtattgtacatgggaataaaaatg |
24682152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University