View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18121_high_21 (Length: 228)
Name: NF18121_high_21
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18121_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 36 - 212
Target Start/End: Original strand, 8676704 - 8676880
Alignment:
| Q |
36 |
caaatcaccatgtaaccacttgaaggattccatgaaaccatttgttttctgaaaaagatctatgatgaaaaacggattgtgtgttttgtgagcaaaggat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8676704 |
caaatcaccatgtaaccacttgaaggattccatgaaaccatttgttttctgaaaaagatctatgatgaaaaacggattgtgtgttttgtgagtaaaggat |
8676803 |
T |
 |
| Q |
136 |
tgtcttctcacaaaggagagaaaattatcttctcagaggagagaaaaaattccacttccacttattaatcaagtttt |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8676804 |
tgtcttctcacaaaggagagagaattatcttctcagaggagagaaaaaattccacttccacttattaataaagtttt |
8676880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University