View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18122_high_17 (Length: 210)

Name: NF18122_high_17
Description: NF18122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18122_high_17
NF18122_high_17
[»] chr3 (2 HSPs)
chr3 (73-195)||(49705082-49705204)
chr3 (18-60)||(49705044-49705086)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 73 - 195
Target Start/End: Original strand, 49705082 - 49705204
Alignment:
73 tttgtatcgacttctaacttcatagtgattatcctctcaaaaaactttattggtattatggtattttgccaacagnnnnnnnnttcttaacaaaaaattt 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||| ||    
49705082 tttgtatcgacttctaacttcatagtgattatcctctcaaaaaactttattggtattatggtattttgccaacagaaaaaaaattcttaacaaaaaaatt 49705181  T
173 tgaagaataatagtatgcttcat 195  Q
    |||||||||||||||||||||||    
49705182 tgaagaataatagtatgcttcat 49705204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 49705044 - 49705086
Alignment:
18 agagatatgttctaacacgcatgacttcgcgagtgatgtttgt 60  Q
    |||||||||||||||||||||||||||||||||||||||||||    
49705044 agagatatgttctaacacgcatgacttcgcgagtgatgtttgt 49705086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University