View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18122_low_17 (Length: 231)
Name: NF18122_low_17
Description: NF18122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18122_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 14748437 - 14748616
Alignment:
| Q |
20 |
tcttgctcattgatttcttcgaaatatttcttttagtaaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748437 |
tcttgctcattgatttcttcgaaatatttcttttagtaaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatct |
14748536 |
T |
|
| Q |
120 |
aaattcttcataccaaatttgtagtacaatttaggcatgatgggttggtggagagtatcagaagacaagacaagaataat |
199 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14748537 |
aaattcttcataccaaatttggaatacaatttaggcatgatgggttggtggagagtatcagaagacaagacaagaataat |
14748616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University