View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18122_low_19 (Length: 210)
Name: NF18122_low_19
Description: NF18122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18122_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 73 - 195
Target Start/End: Original strand, 49705082 - 49705204
Alignment:
| Q |
73 |
tttgtatcgacttctaacttcatagtgattatcctctcaaaaaactttattggtattatggtattttgccaacagnnnnnnnnttcttaacaaaaaattt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
49705082 |
tttgtatcgacttctaacttcatagtgattatcctctcaaaaaactttattggtattatggtattttgccaacagaaaaaaaattcttaacaaaaaaatt |
49705181 |
T |
 |
| Q |
173 |
tgaagaataatagtatgcttcat |
195 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49705182 |
tgaagaataatagtatgcttcat |
49705204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 49705044 - 49705086
Alignment:
| Q |
18 |
agagatatgttctaacacgcatgacttcgcgagtgatgtttgt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705044 |
agagatatgttctaacacgcatgacttcgcgagtgatgtttgt |
49705086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University