View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18124_low_14 (Length: 389)
Name: NF18124_low_14
Description: NF18124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18124_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 16202981 - 16203356
Alignment:
| Q |
1 |
tgcagagtagattttgtctgtgtaagtgttgttgccttggtttgatgagttctccattgattcatagtgtagatgaggttgttctccaagtgttgtgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16202981 |
tgcagagtagattttgtctgtgtaagtgttgttgccttggtttgatgagttctccattgattcatagtgtagatgcggttgttctccaagtgttgtgttt |
16203080 |
T |
|
| Q |
101 |
ttgttgtactgttcatggcttccagctgaagggtattgagttttcattgcactagagtgttgtggttgcatatattgaccatgacttgtagcagaatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16203081 |
ttgttgtactgttcatggcttccagctgaagggttttgagttttcattgcactagagtgttgtggttgcatatattgaccatgacttgtagcagaatggt |
16203180 |
T |
|
| Q |
201 |
gttcagttggtaaccctgccctaaactgatcatggcttccagaagacgggtacggagtttgcattgcacctgaatgatgtggcaagtttgtagcagattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16203181 |
gttcagttggtaaccctgccctaaactgatcatggcttccagaagatgggtacggagtttgcattgcacctgaatgatgtggcaagtttgtagcagattg |
16203280 |
T |
|
| Q |
301 |
gtgttgaggattagcctcagttgcactagaatatggtgacaaatattggtcttcactagtgtttaaagggtgatga |
376 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16203281 |
gtgttgaggattagcctcagtagcactagaatatggtgacaaatattggtcttcactagtgtttaaagggtgatga |
16203356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University