View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18124_low_26 (Length: 302)
Name: NF18124_low_26
Description: NF18124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18124_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 20 - 292
Target Start/End: Complemental strand, 5328392 - 5328120
Alignment:
| Q |
20 |
agcccagtcatgttcagcggtagctgtccttgtcgcgacagttgtctttgcggcagcttacactgtccctggaggcacagacgaccgcggcttcccaagg |
119 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5328392 |
agcccagtcatgttctgcggtagctgcccttgtcgcgacagttgtctttgcggcagcttacactgtcccgggaggcacagacgaccacggcttcccaagg |
5328293 |
T |
|
| Q |
120 |
ttactccatcatcctatatttgtagtgttcatggtcatggatgttgtggcacttgcaagttcattggcatcagtggttatgttcctctcaatcctcacat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5328292 |
ttactccatcatcctatatttgtagtgttcatggtcatggatgttgtggcacttgcaagttcattggcatcagtggttatgttcctctcaatcctcacat |
5328193 |
T |
|
| Q |
220 |
caccttgtaagttatgggattttaggaggtctctacctaggaaactaatggcaggtttttccttcttgttctt |
292 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5328192 |
caccttgtgagttatgggattttaggaggtctctacctaggaaactaatggcaggttttgccttcttgttctt |
5328120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 24 - 292
Target Start/End: Original strand, 5317223 - 5317491
Alignment:
| Q |
24 |
cagtcatgttcagcggtagctgtccttgtcgcgacagttgtctttgcggcagcttacactgtccctggaggcacagacgaccgcggcttcccaaggttac |
123 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||| || |||||||| ||||| ||||||||||||||| |||||| ||||| |||| |
|
|
| T |
5317223 |
cagtcatgttctgcggtagctgtccttgttgcgacagttgtctttgcagctgcttacacggtcccaggaggcacagacgactacggcttgccaagattac |
5317322 |
T |
|
| Q |
124 |
tccatcatcctatatttgtagtgttcatggtcatggatgttgtggcacttgcaagttcattggcatcagtggttatgttcctctcaatcctcacatcacc |
223 |
Q |
| |
|
| |||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
5317323 |
ttcatcatcctatattcgtagtgttcacagtcatggatgttgtggcccttgcaagttcattggcttcagttgttatgtttctctcaatcctcacatcacc |
5317422 |
T |
|
| Q |
224 |
ttgtaagttatgggattttaggaggtctctacctaggaaactaatggcaggtttttccttcttgttctt |
292 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
5317423 |
ttgtgagttgtgggattttaggaggtctctacctaggaaactaatggcaggtttcgcattcttgttctt |
5317491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University