View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18124_low_32 (Length: 251)
Name: NF18124_low_32
Description: NF18124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18124_low_32 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 16202748 - 16202980
Alignment:
| Q |
19 |
tcaccagttgttgtctcgcctgtttcactgccatatccaatctttgaagcaaccgcgtttgtagcatcagcggctttgttagtgactgcagacgctgcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16202748 |
tcaccagttgttgtctcgcctgtttcactgccatatccaatctttgaagcaaccgcgtttgtagcatcagcggctttgttagtgactgcagacgctgcag |
16202847 |
T |
 |
| Q |
119 |
agtagattttgtctgtgtaaccgctttgattcaatggcgcttcagcagtagttgtctcccctttctctccatatccaagcttcgaagctaccgcattttt |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16202848 |
agtagattttgtctgtgtaactgctttgattcaatggcgcttcagcagtagttgtctcccctttctctccatatccaagcttcgaagctaccgcattttt |
16202947 |
T |
 |
| Q |
219 |
agcactggcagctgtgtcggcaattgcagaagt |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
16202948 |
agcaccggcagctgtgtcggcaattgcagaagt |
16202980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 137
Target Start/End: Original strand, 16202514 - 16202599
Alignment:
| Q |
52 |
tatccaatctttgaagcaaccgcgtttgtagcatcagcggctttgttagtgactgcagacgctgcagagtagattttgtctgtgta |
137 |
Q |
| |
|
||||||| |||||||||||| || ||| ||||| |||| ||||||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
16202514 |
tatccaagctttgaagcaacggcatttttagcaccagcagctttgtcggtgactgcagaagctgcattatagattttgtctgtgta |
16202599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University