View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18124_low_38 (Length: 229)
Name: NF18124_low_38
Description: NF18124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18124_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 23188287 - 23188485
Alignment:
| Q |
16 |
tgaaccaaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatacaaattgcaaaaggtcatagcatcaaatat--atattaacaaaattcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23188287 |
tgaaccaaataaaattcaaaaagaaaaccaaatttagtttcgtagctgatgcaaattgcaaaaggtcatagcatcaaatatatatattaacaaaattcat |
23188386 |
T |
 |
| Q |
114 |
tttgaaaaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatcttct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188387 |
tttgaaaaattgtcaaactcttgtttctgcgttgtgcttttctcggttctatgaggtgcttcgtgcacaaacaatgtatagcagattgtgtcatcttct |
23188485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University