View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18125_high_5 (Length: 485)
Name: NF18125_high_5
Description: NF18125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18125_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 2e-90; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 38305270 - 38305076
Alignment:
| Q |
10 |
gcagagaggaagacggagtgacggagagagaagcggcggtgagtatgttggcgag--tgagaaaatggaaaatgaaagttcctaggcttggtatttatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38305270 |
gcagagaggaagacggagtgacggagagagaagcggcggtgagtatgttggcgagagtgagaaaatggaaaatgaaagttcctaggcttggtatttatat |
38305171 |
T |
|
| Q |
108 |
ctctc--aaaggaacaaaatgcttttcccttcaaaaccctaaaccgggcacccgcgtcgggttaaacgggttagccgtttgattcatctgttcac |
200 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38305170 |
ctctctcaaaggaacaaaatgcttttcacttcaaaaccctaaaccgggcacccgcgtcgggttaaacgggttagccgtttgattcatctgttcac |
38305076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 331 - 468
Target Start/End: Complemental strand, 38304975 - 38304840
Alignment:
| Q |
331 |
ttaagattaaatgcacacagaataaatattgagaattgaaacatttcacttgcaccttaatatatcaaatatatgagcaatgctacagacacacgatctc |
430 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38304975 |
ttaagattaaatgcacacagaataaatgttgagaattgaaacatttcacttgcaccttaatatatcaa--atatgagcaatgctacagacacacgatctc |
38304878 |
T |
|
| Q |
431 |
acagacgcttttgaacatttcccttgtcattggtccac |
468 |
Q |
| |
|
||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
38304877 |
acaaacgcttttgaacacttcccctgtcattggtccac |
38304840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 107 - 179
Target Start/End: Complemental strand, 38312548 - 38312476
Alignment:
| Q |
107 |
tctctcaaaggaacaaaatgct-tttcccttcaaaaccctaaaccgggcacccgcgtcgggttaaacgggttag |
179 |
Q |
| |
|
|||||||| |||||||| ||| |||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38312548 |
tctctcaagggaacaaactgccctttcaattcaaaaccctaaaccgggcacc-gcgtcgggttaaacgggttag |
38312476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 421 - 468
Target Start/End: Original strand, 44166088 - 44166135
Alignment:
| Q |
421 |
acacgatctcacagacgcttttgaacatttcccttgtcattggtccac |
468 |
Q |
| |
|
||||||||| ||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
44166088 |
acacgatctaacaaacgcttttgagcacttcccttgtcattggtccac |
44166135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University