View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18125_low_17 (Length: 341)
Name: NF18125_low_17
Description: NF18125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18125_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 204 - 323
Target Start/End: Complemental strand, 7965880 - 7965761
Alignment:
| Q |
204 |
ttaacattggaaacgttgggtagtaaaagggtaataaggaactgcaaagtttcccttcaaaactaagcaatggtaagtaactaggaaaataattgacaaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7965880 |
ttaacattggaaacgttgggtagtaaaagggtaataaggaactgcaaagtttcccttcaaaactaagcaatggtaagtaactaggaaaataattgagaaa |
7965781 |
T |
|
| Q |
304 |
agttcatcagtacacactac |
323 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7965780 |
agttcatcagtacacactac |
7965761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 7966077 - 7965947
Alignment:
| Q |
7 |
actatatgaggtttatattgtctttaatttttattattt-aaaaaagcaagcactccctttcagtcaccttcatccctagactcaccatagctaaccttg |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7966077 |
actatatgaagtttatattgtctttaatttttattattttaaaaaagcaagcactccctttcagtcaccttcatccctagactcaccatagttaaccttg |
7965978 |
T |
|
| Q |
106 |
ttaatttcaaggttattaactctaaacatat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7965977 |
ttaatttcaaggttattaactctaaacatat |
7965947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University