View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18126_high_11 (Length: 249)
Name: NF18126_high_11
Description: NF18126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18126_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 14856514 - 14856300
Alignment:
| Q |
17 |
tgaaaatggcacaaattgcaattgatactatgggaaaaggttagtttattcatagattttacttgtttgcatgtgtggttatgctttgtttgaattatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14856514 |
tgaaaatggcacaaattgcaattgatactatgggaaaaggttagtttattcatagattttacttgtttgcatgtgtggttatgctttgtttgaattatgt |
14856415 |
T |
 |
| Q |
117 |
cggcttcgattgtgaccaatatttcatcctcataaaatgttaaattagtaatttttaatatcatgatgattttcttcttcttttgttagcaaaatattcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14856414 |
cggcttcgattgtgaccaatatttcatcctcataaaatgttaaattagtaatttttaatatcatgatgattttcttcttcttttgttagcaaaatattcc |
14856315 |
T |
 |
| Q |
217 |
accatatattataca |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14856314 |
accatatattataca |
14856300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University