View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_high_37 (Length: 227)
Name: NF18127_high_37
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 167
Target Start/End: Complemental strand, 43478946 - 43478797
Alignment:
| Q |
18 |
atcgttggggatttgcgaagactccaaaaccctagtaaaaaatttggtaagaatagtgtttgcagaatgaaaagaaacttgattttaatggaaatttctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43478946 |
atcgttggggatttgcgaagactccaaaaccctagtaaattttttggtaagaatagtgtttgcagaatgaaaagaaacttgattttaatggaaatttctt |
43478847 |
T |
|
| Q |
118 |
tgttcggtagctgcctcatgcgtttaatggtacattccgtttgcaatcaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43478846 |
tgttcggtagctgcctcatgcgtttaatggtacattccgtttgcagtcaa |
43478797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 43478790 - 43478739
Alignment:
| Q |
157 |
tttgcaatcaattgctgttaaggtgatgtttgtgatcgctcatttttgcgac |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43478790 |
tttgcaatcaattgttgttaaggtgatgtttgtgatcgctcgtttttgcgac |
43478739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University