View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_low_26 (Length: 325)
Name: NF18127_low_26
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 97 - 304
Target Start/End: Original strand, 39918352 - 39918559
Alignment:
| Q |
97 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918352 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
39918451 |
T |
|
| Q |
197 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgacaacgttgcatcagttaaacttttcaccgacaaatgcg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgataacgttgcatcagttaaacttttcaccgacaaatgcg |
39918551 |
T |
|
| Q |
297 |
gttactca |
304 |
Q |
| |
|
|||||||| |
|
|
| T |
39918552 |
gttactca |
39918559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39918256 - 39918303
Alignment:
| Q |
1 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918256 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
39918303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University