View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_low_28 (Length: 309)
Name: NF18127_low_28
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 35472950 - 35473101
Alignment:
| Q |
1 |
ttagtttcatatcggcggtatctactacaaagttaaatataaagccgatggcactgatataaggctaggcttgtcgcaaaaggttttgatttctttgacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472950 |
ttagtttcatatcggcggtatctactacaaagttaaatataaagccgatggcactgatataagactaggcttgtcgcaaaaggttttgatttctttgacg |
35473049 |
T |
 |
| Q |
101 |
tttattgtcctgtggtgaagttaaaccactgtaagactcattcttgctattgc |
153 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35473050 |
tttattctcctgtggtgaagtt-aaccactgtaagactcattcttgctattgc |
35473101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University