View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_low_30 (Length: 298)
Name: NF18127_low_30
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 24949269 - 24949169
Alignment:
| Q |
187 |
aacttacgtattat---acgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
283 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949269 |
aacttacgtattattctacgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
24949170 |
T |
 |
| Q |
284 |
t |
284 |
Q |
| |
|
| |
|
|
| T |
24949169 |
t |
24949169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 40 - 113
Target Start/End: Complemental strand, 24949418 - 24949345
Alignment:
| Q |
40 |
tgtgttactgatctgatcagtggatcatcggtcagatcacatgattattgacctagacattgatgagaaattct |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
24949418 |
tgtgttactgatctaatcagtggatcatcggtcggatcccatgactattgaccgagacattgatgagaaattct |
24949345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University