View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18127_low_31 (Length: 279)
Name: NF18127_low_31
Description: NF18127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18127_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 53064935 - 53065140
Alignment:
| Q |
16 |
atgagacaaacaggtgaaatgttatttcatttcttttaatatgatctctaattatataggacaattatatgttgactacnnnnnnnnntacaccttaagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53064935 |
atgagacaaacaggtgaaatgttatttcatttcttttaatatgatctctaattatataggacaattatatgttgactacaaaaaaaaatacaccttaagt |
53065034 |
T |
 |
| Q |
116 |
atatatctcagttggagaggtaagagacatgtaagaagttttaggtaggtaaagagttcaaactttgaaatctaacctaatcacgaacttcctaacattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53065035 |
atatatctcagttggagaggtaagagacatgtaagaagttttaggtaggtaaagagttcaaactttgaaatctaacctaatcacgaacttcctaacattt |
53065134 |
T |
 |
| Q |
216 |
gtctat |
221 |
Q |
| |
|
|||||| |
|
|
| T |
53065135 |
gtctat |
53065140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University